header

genetic-algorithms.com

 

Inspect guest6709_0_1_18

Parents

Mother

Image 01

guest6709_0_0_27

Genome: ATCACCCCGCCTGCAGAACCGTGTGCCCTG

Father

Image 01

guest6709_0_0_1

Genome: ATGGTTGTCTATTCACCGGCGGAGATTTGA

guest6709_0_1_18

Image 01

  • Creator: guest6709
  • Population: 0
  • Generation: 1
  • Total Fitness: 9
  • No. Votes: 1
  • Avg. Fitness 9
  • Created: 03/06/2023
  • Genome: GATATCGTTGTCTATTCACCGGCGGAGATTAGG
  • Function:

    numbers('yxy') if numbers("xyx") > numbers('yxy') else numbers("xyx") if numbers('yxy') > numbers('rrr') else numbers('yxy') if band pass(numbers("xyx") if numbers('rrr') > numbers('yxy') else numbers('yxy') if numbers('yxy') if numbers('yxy') > numbers("xyx") else numbers("xyx") if numbers('yxy') > numbers('rrr') else numbers('yxy') > numbers('yxy') if numbers("xyx") > numbers('rrr') if numbers('yxy') > numbers('yxy') else numbers("xyx") else numbers('yxy') if numbers('yxy') > numbers('yxy') else numbers('rrr') if numbers('yxy') > numbers("xyx") else numbers('yxy') else numbers('yxy')) > numbers('yxy') if numbers('rrr') if numbers('yxy') > numbers("xyx") else numbers('yxy') > numbers("xyx") else numbers('yxy') if numbers('yxy') > numbers('yxy') if numbers('yxy') if numbers('yxy') > numbers('rrr') else numbers("xyx") > numbers('yxy') else numbers('yxy') if numbers('rrr') if numbers('yxy') > numbers('yxy') else numbers("xyx") > numbers('yxy') else numbers("xyx") else numbers('rrr') if numbers('yxy') > numbers("xyx") else numbers('yxy') else numbers("xyx") if numbers('rrr') if numbers("xyx") > numbers('yxy') else numbers('yxy') > numbers('yxy') else numbers('yxy') if numbers('yxy') > numbers('yxy') if numbers("xyx") > numbers('yxy') else numbers('rrr') else numbers('yxy')

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest6709_0_2_5

Image 01

Genome: ACAACTACAGTGGTCCTATCACCGGCGTTTACG

guest6709_0_2_13

Image 01

Genome: CCGCATCCAGATTACCTTTTTTGTCCTAGAGCC

guest6709_0_2_17

Image 01

Genome: GAGCGAGTTGTCTATTCACCGGCGGATTAT