• Creator: guest171
• Population: 0
• Generation: 0
• Total Fitness: 9
• No. Votes: 1
• Avg. Fitness 9
• Created: 05/19/2019
• Genome: TTTAGCACTCTGCCTCGCTATAACTTGGGA
• Function:

  divide(numbers('xry'), numbers("yxx")) if mean(divide(numbers('xry'), numbers("yxx")), numbers('xry')) > cos(2 *(mean(divide(numbers('xry'), numbers("yxx")), numbers('xry')))) else 2 *(mean(divide(numbers('xry'), numbers("yxx")), numbers('xry')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.