• Creator: guest171
• Population: 0
• Generation: 2
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 05/19/2019
• Genome: TACAGAGAAGTTATGACTCGGTGTTGCTAGGGT
• Function:

  numbers('yxr') if sqrt(2 *(numbers('yxr'))) > numbers('ryy') else 2 *(numbers('yxr')) if sqrt(2 *(numbers('yxr'))) > numbers('yxr') else 2 *(numbers('yxr')) if sqrt(2 *(numbers('yxr'))) > sin(numbers('yxr') if 2 *(numbers('yxr')) > numbers('ryy') if numbers('yxr') > 2 *(numbers('yxr')) else sqrt(2 *(numbers('yxr'))) else sqrt(2 *(numbers('yxr')))) else numbers('ryy') if numbers('yxr') > sqrt(2 *(numbers('yxr'))) else 2 *(numbers('yxr'))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.