• Creator: guest171
• Population: 0
• Generation: 3
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/19/2019
• Genome: GCGGTCACTATGAATCTTTCTCTGTCCTAGTTA
• Function:

  sqrt(noise(round(numbers('xyy'), numbers('epe')))) if noise(round(numbers('xyy'), numbers('epe'))) > sqrt(noise(round(numbers('xyy'), numbers('epe')))) if 2 *(sqrt(noise(round(numbers('xyy'), numbers('epe'))))) > round(numbers('xyy'), numbers('epe')) else noise(round(numbers('xyy'), numbers('epe'))) else 2 *(sqrt(noise(round(numbers('xyy'), numbers('epe')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.