• Creator: Citrus00
• Population: 0
• Generation: 12
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/19/2019
• Genome: CAGCGAACCCGCACGGCCACTCCTACCGTGACATCAAAGGAG
• Function:

  minus(mod(10 *(round(100 *(numbers('xyy') if numbers('epe') > numbers('yyx') else 2 *(numbers('xyy'))), numbers('xyy') if 2 *(numbers('xyy')) > numbers('yyx') else numbers('epe'))), round(100 *(numbers('yyx') if numbers('epe') > 2 *(numbers('xyy')) else numbers('xyy')), 2 *(numbers('xyy')) if numbers('xyy') > numbers('epe') else numbers('yyx'))), 10 *(round(100 *(numbers('yyx') if numbers('xyy') > 2 *(numbers('xyy')) else numbers('epe')), numbers('epe') if numbers('xyy') > numbers('yyx') else 2 *(numbers('xyy')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.