• Creator: Citrus00
• Population: 0
• Generation: 13
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 05/19/2019
• Genome: TGTATAACTCGAACGCTCACTCCTACGACA
• Function:

  100 *(numbers('rep')) if 2 *(mod(100 *(numbers('rep')), numbers('rep'))) > logn(2 *(mod(100 *(numbers('rep')), numbers('rep')))) else mod(100 *(numbers('rep')), numbers('rep'))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.