• Creator: guest195
• Population: 0
• Generation: 0
• Total Fitness: 4
• No. Votes: 1
• Avg. Fitness 4
• Created: 05/19/2019
• Genome: GTGCTAAATAGAACCCGGGTATGACCTTTT
• Function:

  noise(sin(10 *(numbers('yxr')))) if max(noise(sin(10 *(numbers('yxr')))), sin(10 *(numbers('yxr')))) > 10 *(numbers('yxr')) else sin(10 *(numbers('yxr')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.