• Creator: guest195
• Population: 0
• Generation: 1
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 05/19/2019
• Genome: TCGGTGCTAAATATAATCCGGATATGACCTTTT
• Function:

  max(noise(logn(band pass(numbers('yxr')))), logn(band pass(numbers('yxr')))) if logn(band pass(numbers('yxr'))) > noise(logn(band pass(numbers('yxr')))) else noise(logn(band pass(numbers('yxr')))) if band pass(numbers('yxr')) > logn(band pass(numbers('yxr'))) else max(noise(logn(band pass(numbers('yxr')))), logn(band pass(numbers('yxr'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.