header

genetic-algorithms.com

 

Inspect guest8200_0_0_9

Parents

guest8200_0_0_9 has no parents. It was generated at random.

guest8200_0_0_9

Image 01

  • Creator: guest8200
  • Population: 0
  • Generation: 0
  • Total Fitness: 9
  • No. Votes: 1
  • Avg. Fitness 9
  • Created: 02/11/2024
  • Genome: AGCGTCGTAGTGCTTCGGGTACTTAACCCC
  • Function:

    cos(numbers('rrr') if numbers("per") > round(numbers('yxr'), numbers("per")) else numbers('yxr') if numbers('yxr') > numbers("per") if numbers('yxr') > numbers('yxr') if numbers("per") > numbers('rrr') else round(numbers('yxr'), numbers("per")) else round(numbers('yxr'), numbers("per")) else round(numbers('yxr'), numbers("per")))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest8200_0_1_0

Image 01

Genome: CCAACTTGGTGGGTCTGCCGATATCCGGCAACC

guest8200_0_1_8

Image 01

Genome: TGAACTCACGTAGTGCTTCGGGTACTTACCCCC

guest8200_0_1_13

Image 01

Genome: TATAGCGTCGTAGTGCTTCGGGTACTTAACCCC

guest8200_0_1_26

Image 01

Genome: AGAGTAGTAGTGCTTCGGGTACTTAGCCCC

guest8200_0_1_14

Image 01

Genome: GCCACTCCGGTAGTGCTGGGGATGCAAACTCGC

guest8200_0_1_17

Image 01

Genome: GGGTTCATAGTTCTTCGGGTTCGCGGCGCG

guest8200_0_1_26

Image 01

Genome: AGAGTAGTAGTGCTTCGGGTACTTAGCCCC