header

genetic-algorithms.com

 

Inspect guest8200_0_1_14

Parents

Mother

Image 01

guest8200_0_0_20

Genome: ACTCCGAACCCCATGGGGATGCAAACTCTC

Father

Image 01

guest8200_0_0_9

Genome: AGCGTCGTAGTGCTTCGGGTACTTAACCCC

guest8200_0_1_14

Image 01

  • Creator: guest8200
  • Population: 0
  • Generation: 1
  • Total Fitness: 8
  • No. Votes: 1
  • Avg. Fitness 8
  • Created: 02/11/2024
  • Genome: GCCACTCCGGTAGTGCTGGGGATGCAAACTCGC
  • Function:

    2 *(divide(mean(numbers('yxr'), numbers('epe')) if numbers('yxr') > numbers('epe') else mean(numbers('yxr'), numbers('epe')) if numbers('epe') > numbers('yxr') else numbers("xxx"), mean(numbers('yxr'), numbers('epe')) if numbers('epe') > numbers("xxx") else numbers('yxr'))) if divide(numbers('epe') if numbers('yxr') > mean(numbers('yxr'), numbers('epe')) else numbers('yxr') if numbers('epe') > numbers("xxx") else mean(numbers('yxr'), numbers('epe')), numbers('epe') if numbers('yxr') > mean(numbers('yxr'), numbers('epe')) else numbers("xxx")) > numbers('yxr') if mean(numbers('yxr'), numbers('epe')) > numbers('epe') else numbers("xxx") if numbers('epe') > numbers('yxr') else mean(numbers('yxr'), numbers('epe')) else numbers("xxx") if mean(numbers('yxr'), numbers('epe')) > numbers('epe') else numbers('yxr')

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest8200_0_2_1

Image 01

Genome: AAGGCGACTCCGGTAGTGCTGGGGATGCAAACTCGC

guest8200_0_2_25

Image 01

Genome: CCACCTCCAAAGCTGAAACCGTGCTAGACT