• Creator: guest8200
• Population: 0
• Generation: 0
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 02/11/2024
• Genome: ACTCCGAACCCCATGGGGATGCAAACTCTC
• Function:

  2 *(divide(square(product(sqrt(numbers('yxr')), numbers('yxr'))), product(sqrt(numbers('yxr')), numbers('yxr'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.