header

genetic-algorithms.com

 

Inspect guest8200_0_2_24

Parents

Mother

Image 01

guest8200_0_1_16

Genome: TAAAGAATTACGCCTCCATGTGGATACTTA

Father

Image 01

guest8200_0_1_18

Genome: GTTCCTTGGTGGGGGCGGGGATATCTGACAAGT

guest8200_0_2_24

Image 01

  • Creator: guest8200
  • Population: 0
  • Generation: 2
  • Total Fitness: 8
  • No. Votes: 1
  • Avg. Fitness 8
  • Created: 02/11/2024
  • Genome: TCGTAAAGAAATACGCCGCCAAGCGATTACTTA
  • Function:

    sin(noise(100 *(divide(numbers("yyy"), numbers('xry'))))) if 100 *(divide(numbers("yyy"), numbers('xry'))) if noise(100 *(divide(numbers("yyy"), numbers('xry')))) > sin(noise(100 *(divide(numbers("yyy"), numbers('xry'))))) else divide(numbers("yyy"), numbers('xry')) > 100 *(divide(numbers("yyy"), numbers('xry'))) else noise(100 *(divide(numbers("yyy"), numbers('xry'))))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest8200_0_3_19

Image 01

Genome: TTTTCTTAAAGAAATAGGCCGCCAAGCGATAACTTA

guest8200_0_3_7

Image 01

Genome: CCGACTTGTAGGTTTACTCAACCTCTTGGCAACCGT

guest8200_0_3_14

Image 01

Genome: ATCTAGTCGATCTAATACGGAGCCAGCGATTTC

guest8200_0_3_22

Image 01

Genome: CCGCGTGTAGTTAATACGCGGCCAAAAGGATATCTA

guest8200_0_3_23

Image 01

Genome: CAGAGACAAAATAAGCCGTCAAGCGCCTGA