• Creator: guest8200
• Population: 0
• Generation: 3
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 02/11/2024
• Genome: CCGCGTGTAGTTAATACGCGGCCAAAAGGATATCTA
• Function:

  divide(log(100 *(numbers('yxr')) if numbers('yxr') > noise(100 *(numbers('yxr'))) else numbers('yxr') if numbers("yyy") > 100 *(numbers('yxr')) else noise(100 *(numbers('yxr'))), noise(100 *(numbers('yxr'))) if numbers("yyy") > 100 *(numbers('yxr')) else numbers('yxr')), numbers('yxr') if noise(100 *(numbers('yxr'))) > numbers('yxr') if noise(100 *(numbers('yxr'))) > 100 *(numbers('yxr')) else numbers("yyy") else 100 *(numbers('yxr')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.