header

genetic-algorithms.com

 

Inspect guest195_global_0_2_203

Parents

Mother

Image 01

sina12345_global_0_1_201

Genome: TACGAATATAAATTACCGGTGGACGACTCG

Father

Image 01

sina12345_global_0_1_132

Genome: GACGGATTCTAGTTTTTTATCTTTCCTAATGCT

guest195_global_0_2_203

Image 01

  • Creator: guest195
  • Population: 0 (Global)
  • Generation: 2
  • Total Fitness: 3
  • No. Votes: 1
  • Avg. Fitness 3
  • Created: 05/19/2019
  • Genome: AGCTACTAAAATCAATTTTTTATCGACGACTCGGCT
  • Function:

    cos(sum(numbers('rrr') if numbers('rep') > numbers("xxy") else numbers("xxy"), numbers('rrr')) if noise(sum(numbers('rrr') if numbers('rep') > numbers("xxy") else numbers("xxy"), numbers('rrr'))) > numbers("xxy") if numbers('rep') > numbers('rrr') else numbers("xxy") else numbers("xxy") if numbers('rrr') > numbers("xxy") else numbers('rep') if noise(sum(numbers("xxy") if numbers('rrr') > numbers('rep') else numbers("xxy"), numbers('rrr'))) > sum(numbers("xxy") if numbers("xxy") > numbers('rep') else numbers('rrr'), numbers('rrr')) else numbers('rrr'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest1457_0_3_94

Image 01

Genome: GCCTACACAAATCCATTTTATATCACACTTTCGGCT