header

genetic-algorithms.com

 

Inspect sina12345_global_0_1_132

Parents

Mother

Image 01

global_global_0_0_50

Genome: CGATTATAAACTAGACCTCGGCATTGTCCT

Father

Image 01

global_global_0_0_22

Genome: GACGTCTAGTTTTTTACCTTTCCTAATAAT

sina12345_global_0_1_132

Image 01

  • Creator: sina12345
  • Population: 0 (Global)
  • Generation: 1
  • Total Fitness: 7
  • No. Votes: 3
  • Avg. Fitness 2.3
  • Created: 05/19/2019
  • Genome: GACGGATTCTAGTTTTTTATCTTTCCTAATGCT
  • Function:

    numbers('rrr') if numbers('rep') > numbers('rrr') if numbers('xyy') > numbers("yxx") else numbers('rep') else numbers('rep') if numbers('xyy') > numbers('rep') if numbers("yxx") > numbers('xyy') else numbers('rrr') else numbers('rrr') if numbers('xyy') if numbers('rrr') > numbers("yxx") if numbers('rep') > numbers('rrr') else numbers('xyy') else numbers('rep') if numbers('rep') if numbers('xyy') if numbers('rrr') > numbers('rep') else numbers("yxx") > numbers('xyy') if numbers("yxx") if numbers('rrr') > numbers('rep') else numbers('xyy') > numbers('rep') else numbers('rrr') else numbers('rrr') > numbers('xyy') if numbers('rrr') > numbers('rep') else numbers("yxx") else numbers("yxx") if numbers('rrr') > numbers('rep') else numbers('xyy') if numbers('rrr') if numbers('rep') > numbers('xyy') else numbers("yxx") if numbers('xyy') > numbers('rrr') else numbers('rep') > numbers('rrr') if numbers('xyy') if numbers('rrr') > numbers("yxx") else numbers('rep') > numbers('rep') else numbers('rrr') if numbers('rrr') if numbers('xyy') > numbers('rep') else numbers("yxx") > numbers('rep') else numbers('xyy') else numbers('rep') > numbers('rrr') if numbers('rrr') if numbers('rep') > numbers("yxx") else numbers('xyy') > numbers('rep') if numbers('rrr') > numbers('xyy') else numbers("yxx") if numbers('xyy') > numbers('rrr') else numbers('rep') else numbers('rep') if numbers('rep') > numbers('rrr') if numbers('xyy') > numbers("yxx") else numbers('rep') else numbers('rep') if numbers('rrr') > numbers('xyy') else numbers('rep') if numbers("yxx") > numbers('xyy') else numbers('rrr') else numbers('xyy') if numbers("yxx") > numbers('rrr') else numbers('rep') if numbers('xyy') > numbers('rep') else numbers('rrr')

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

sina12345_0_2_84

Image 01

Genome: GACGGAATCTAGTTGAGACCTACAGATAATGCT

guest195_0_2_203

Image 01

Genome: AGCTACTAAAATCAATTTTTTATCGACGACTCGGCT

guest195_0_2_186

Image 01

Genome: TAGGCATACATCAATTTTAACTTTCCTAAC

guest94_0_2_144

Image 01

Genome: TTTCATCAAACTGCGCTGATACCGGGAACCAAG