header

genetic-algorithms.com

 

Inspect guest195_global_0_1_325

Parents

Mother

Image 01

global_global_0_0_155

Genome: TAATATTTGATCGCCAACGTTCAATCTGAG

Father

Image 01

Genome:

guest195_global_0_1_325

Image 01

  • Creator: guest195
  • Population: 0 (Global)
  • Generation: 1
  • Total Fitness: 9
  • No. Votes: 1
  • Avg. Fitness 9
  • Created: 05/19/2019
  • Genome: TCATATTCGACCGCTAACGTTCAATCTGAG
  • Function:

    10 *(numbers("xxx") if numbers('rrr') > numbers("xxy") else numbers('xyy')) if numbers('rrr') if numbers('xyy') > numbers("xxx") else numbers("xxy") > numbers("xxy") else numbers('rrr') if 10 *(numbers("xxy") if numbers('xyy') > numbers('rrr') else numbers("xxx")) > numbers("xxy") else numbers('xyy') if numbers("xxx") > numbers('rrr') else numbers("xxy") if numbers("xxx") if numbers("xxy") > numbers('xyy') else numbers('rrr') > 10 *(numbers('xyy') if numbers("xxx") > numbers("xxy") else numbers('rrr')) else numbers("xxx") if numbers('rrr') > numbers("xxy") else numbers('xyy') if 10 *(numbers('rrr') if numbers('xyy') > numbers("xxx") else numbers("xxy")) > numbers("xxy") else numbers('rrr')

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest1268_0_2_247

Image 01

Genome: TCATATTCGACCGTAAGGTCAAGTTCTTAG