header

genetic-algorithms.com

 

Inspect global_global_0_0_155

Parents

global_global_0_0_155 has no parents. It was generated at random.

global_global_0_0_155

Image 01

  • Creator: global
  • Population: 0 (Global)
  • Generation: 0
  • Total Fitness: 18
  • No. Votes: 5
  • Avg. Fitness 3.6
  • Created: 05/19/2019
  • Genome: TAATATTTGATCGCCAACGTTCAATCTGAG
  • Function:

    band pass(numbers('rrr') if numbers('xyy') > numbers("xxy") else numbers("xxx")) if numbers('rrr') if numbers("xxy") > numbers('rrr') if numbers("xxx") > numbers("xxy") else numbers('xyy') else band pass(numbers("xxy") if numbers("xxx") > numbers('xyy') else numbers('rrr')) > numbers("xxx") if numbers('xyy') > numbers('rrr') else numbers("xxy") else band pass(numbers('xyy') if numbers('rrr') > numbers("xxx") else numbers("xxy")) if numbers('rrr') if numbers('xyy') > numbers("xxy") else numbers("xxx") > numbers("xxy") else numbers("xxy") if numbers('rrr') > numbers('rrr') if numbers("xxx") > numbers("xxy") else numbers('xyy') else band pass(numbers('xyy') if numbers("xxx") > numbers('rrr') else numbers("xxy"))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest52_0_1_121

Image 01

Genome: CTATAATATTTACTCCTGACCTGTGTGTCAGAC

sina12345_0_1_208

Image 01

Genome: TATGTCGGCGAACCCAACGTTCAATCTGGG

guest75_0_1_259

Image 01

Genome: TAATCTTTGATCGCCCCTCGGCAATCTGAG

guest195_0_1_325

Image 01

Genome: TCATATTCGACCGCTAACGTTCAATCTGAG

guest4634_0_1_345

Image 01

Genome: TCTTAATATTTGATCGCCAAAGTTCAATCTTAG