header

genetic-algorithms.com

 

Inspect guest200_global_0_1_338

Parents

Mother

Image 01

global_global_0_0_192

Genome: ACGTAGAAGTTTGAGCAGACGGATATTCCT

Father

Image 01

Genome:

guest200_global_0_1_338

Image 01

  • Creator: guest200
  • Population: 0 (Global)
  • Generation: 1
  • Total Fitness: 1
  • No. Votes: 1
  • Avg. Fitness 1
  • Created: 05/19/2019
  • Genome: TAGACGTAGCAGTTTGAGCAGAAATGGCTTCCTAAA
  • Function:

    minus(numbers("xyx") if numbers("xxx") > numbers('yxr') else numbers('rrr') if numbers("xxx") > numbers("xyx") else numbers('yxr'), numbers("xxx") if numbers('rrr') > numbers('yxr') else numbers("xyx")) if minus(numbers('yxr') if numbers("xxx") > numbers('rrr') else numbers("xyx") if numbers('yxr') > numbers("xyx") else numbers("xxx"), numbers('yxr') if numbers('rrr') > numbers("xxx") else numbers("xyx")) if numbers("xyx") > numbers("xxx") if numbers("xyx") > numbers('yxr') else numbers("xxx") if numbers("xyx") > numbers('yxr') else numbers('rrr') else numbers('yxr') if numbers('rrr') > numbers("xxx") else numbers("xyx") > numbers("xxx") if numbers("xyx") > numbers('yxr') else numbers('rrr') if numbers("xxx") > numbers("xyx") else numbers('yxr') else 100 *(numbers("xyx") if numbers("xyx") if numbers("xxx") > numbers('rrr') if numbers("xyx") > numbers('yxr') else numbers("xxx") else numbers('yxr') > numbers("xyx") if numbers("xxx") > numbers('yxr') else numbers('rrr') else minus(numbers("xyx") if numbers("xxx") > numbers('yxr') else numbers('rrr') if numbers('yxr') > numbers("xyx") else numbers("xxx"), numbers('yxr') if numbers("xxx") > numbers('rrr') else numbers("xyx")))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest1457_0_2_252

Image 01

Genome: GCCTTGCCGTTTCGGACATCGCAGAACTGGCTTCGT