header

genetic-algorithms.com

 

Inspect global_global_0_0_192

Parents

global_global_0_0_192 has no parents. It was generated at random.

global_global_0_0_192

Image 01

  • Creator: global
  • Population: 0 (Global)
  • Generation: 0
  • Total Fitness: 45
  • No. Votes: 5
  • Avg. Fitness 9
  • Created: 05/19/2019
  • Genome: ACGTAGAAGTTTGAGCAGACGGATATTCCT
  • Function:

    100 *(invert(numbers('yxy') if numbers('rrr') > numbers("xyx") else numbers("yxx") if numbers("xyx") > numbers("yxx") else numbers('yxy')) if numbers('rrr') if numbers("yxx") > numbers('yxy') else numbers("xyx") > numbers('yxy') if numbers("xyx") > numbers('rrr') if numbers("yxx") > numbers('yxy') else numbers("xyx") else numbers("yxx") else numbers("xyx"))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest200_0_1_338

Image 01

Genome: TAGACGTAGCAGTTTGAGCAGAAATGGCTTCCTAAA

guest195_0_1_299

Image 01

Genome: ACGTAGAAGTTTGCGCAGACGGTTATTGCT

guest75_0_1_267

Image 01

Genome: ACGTAGAAGTACGAGCAGACCGATATTTCT

sina12345_0_1_212

Image 01

Genome: TATACGAAGAACTTTGAGCAGACGGATATTCCT

sina12345_0_1_144

Image 01

Genome: AACACGTAGAATTTTGAGCAGACGGATATTTCT

guest195_0_1_322

Image 01

Genome: AGCGGATGTTGGATATGACAGACGCTTTACGTT

guest75_0_1_273

Image 01

Genome: GGAGCTAGTTGGTTTCCGAAGTGGCGCACTAGT

sina12345_0_1_183

Image 01

Genome: CATTAAGCAGGGAAGCTGAGCGATATAGCC

sina12345_0_1_177

Image 01

Genome: AGCTCAGACTACCTATAGTACATACTTCACCCT

sina12345_0_1_161

Image 01

Genome: AGCGCGCGGTTAGAGCAGACTGTGTCCAAA