• Creator: guest200
• Population: 0
• Generation: 0
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 05/19/2019
• Genome: AAGAACTAAGCCAGTGCCCATAGCCAAAGG
• Function:

  invert(square(numbers('yyx') if numbers("yxx") > numbers('xry') if numbers('yyx') > numbers("yxx") else gradient[1](numbers('yyx')) else gradient[1](numbers('yyx'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.