• Creator: guest200
• Population: 0
• Generation: 1
• Total Fitness: 9
• No. Votes: 1
• Avg. Fitness 9
• Created: 05/19/2019
• Genome: AGCTGCGTAGACAGTGCTTGCCATGAATGT
• Function:

  cos(numbers('xyy') if gradient[1](numbers('xyy')) > numbers('xry') else numbers("yxx") if gradient[1](numbers('xyy')) > numbers('xry') else numbers('xyy') if gradient[1](numbers('xyy')) if numbers('xyy') > numbers('xry') else numbers("yxx") > numbers('xyy') else gradient[1](numbers('xyy')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.