• Creator: guest280
• Population: 0
• Generation: 1
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 05/19/2019
• Genome: GGGGCGCAGAGTAGCCCAATTTAAGATGGC
• Function:

  cos(numbers("yyy")) if gradient[1](cos(numbers("yyy"))) > numbers("yyy") else minus(gradient[1](cos(numbers("yyy"))), cos(numbers("yyy"))) if cos(numbers("yyy")) > minus(gradient[1](cos(numbers("yyy"))), cos(numbers("yyy"))) else gradient[1](cos(numbers("yyy")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.