header

genetic-algorithms.com

 

Inspect guest280_0_2_0

Parents

Mother

Image 01

guest280_0_1_27

Genome: GGGGCGCAGAGTAGCCCAATTTAAGATGGC

Father

Image 01

guest280_0_1_6

Genome: GATTCGGGATGGAATGTGCGGAAAACCGGATCA

guest280_0_2_0

Image 01

  • Creator: guest280
  • Population: 0
  • Generation: 2
  • Total Fitness: 3
  • No. Votes: 1
  • Avg. Fitness 3
  • Created: 05/19/2019
  • Genome: TCAGGGGCGCAGAGCAATCTGCGGAAAGATGGC
  • Function:

    minus(cos(noise(numbers('epe'))), noise(numbers('epe'))) if numbers('epe') > cos(noise(numbers('epe'))) else noise(numbers('epe')) if minus(cos(noise(numbers('epe'))), noise(numbers('epe'))) if cos(noise(numbers('epe'))) if numbers('epe') > noise(numbers('epe')) else minus(cos(noise(numbers('epe'))), noise(numbers('epe'))) > noise(numbers('epe')) else cos(noise(numbers('epe'))) > minus(cos(noise(numbers('epe'))), noise(numbers('epe'))) else cos(noise(numbers('epe')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest280_0_3_1

Image 01

Genome: AGGTCTCTCGCGCAGAGCAATCTGCGGAAAGATGGT

guest280_0_3_10

Image 01

Genome: TCGTTTCCGCGTTGGAATCGATGCGCAGGC