• Creator: guest341
• Population: 0
• Generation: 2
• Total Fitness: 9
• No. Votes: 1
• Avg. Fitness 9
• Created: 05/19/2019
• Genome: ACATGTCATCTTACCGAGAGCAACTGTACC
• Function:

  gradient[2](round(10 *(numbers("xyx")), numbers("xyx")) if minus(round(10 *(numbers("xyx")), numbers("xyx")), 10 *(numbers("xyx"))) > numbers("xyx") else 10 *(numbers("xyx")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.