• Creator: guest341
• Population: 0
• Generation: 3
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 05/19/2019
• Genome: TGCAATAATCATCTTACCGAAAGATGCTACATC
• Function:

  round(10 *(numbers("xxx")), numbers("xxx")) if noise(noise(minus(round(10 *(numbers("xxx")), numbers("xxx")), 10 *(numbers("xxx"))))) > minus(round(10 *(numbers("xxx")), numbers("xxx")), 10 *(numbers("xxx"))) else noise(minus(round(10 *(numbers("xxx")), numbers("xxx")), 10 *(numbers("xxx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.