• Creator: guest341
• Population: 0
• Generation: 3
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 05/19/2019
• Genome: ACCTTTGTCACCCTCAAGAGGGCCGCCCAG
• Function:

  10 *(min(numbers("xyx"), numbers('yxr')) if min(numbers("xyx"), numbers('yxr')) if 10 *(min(numbers("xyx"), numbers('yxr'))) > numbers('yxr') else numbers("xyx") > numbers("xyx") else 10 *(min(numbers("xyx"), numbers('yxr'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.