• Creator: guest341
• Population: 0
• Generation: 4
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 05/19/2019
• Genome: GGTGAGATTAGTAGCACGAGGGCCGCCACA
• Function:

  gradient[0](gradient[1](cos(numbers('yxy')))) if numbers('yxy') > gradient[1](cos(numbers('yxy'))) else cos(numbers('yxy')) if cos(numbers('yxy')) > gradient[0](gradient[1](cos(numbers('yxy')))) else gradient[1](cos(numbers('yxy')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.