• Creator: guest341
• Population: 0
• Generation: 5
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 05/19/2019
• Genome: AGCACGACCTAAATTAACTCGCGCTTCCTA
• Function:

  cos(100 *(10 *(numbers("xxy") if numbers('xry') > numbers('yxy') else gradient[0](numbers("xxy")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.