• Creator: guest341
• Population: 0
• Generation: 6
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 05/19/2019
• Genome: AGCACAACCTAAACTAACCGCAGCTCCCTA
• Function:

  cos(gradient[2](10 *(numbers('xry') if numbers('xry') > numbers("xxy") else 2 *(numbers("xxy")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.