header

genetic-algorithms.com

 

Inspect guest47_0_0_9

Parents

guest47_0_0_9 has no parents. It was generated at random.

guest47_0_0_9

Image 01

  • Creator: guest47
  • Population: 0
  • Generation: 0
  • Total Fitness: 7
  • No. Votes: 1
  • Avg. Fitness 7
  • Created: 05/19/2019
  • Genome: GCAGTCAGGCTTTAAGCCTGGGGGATCGGA
  • Function:

    tan(round(numbers('yxr') if numbers('yxr') > numbers('rep') else numbers('yyx'), numbers('yyx'))) if numbers('yxr') if numbers('yyx') > numbers('rep') else numbers('yxr') > round(numbers('yxr') if numbers('yyx') > numbers('yxr') else numbers('rep'), numbers('yyx')) else round(numbers('yxr') if numbers('rep') > numbers('yyx') else numbers('yxr'), numbers('yyx')) if numbers('rep') if numbers('yxr') > numbers('yyx') else numbers('yxr') > tan(round(numbers('yxr') if numbers('yxr') > numbers('yyx') else numbers('rep'), numbers('yyx'))) else numbers('yyx')

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest47_0_1_1

Image 01

Genome: GGAGTCAGGCTTTAAGCCTGGGGGATCGGA

guest47_0_1_8

Image 01

Genome: AGACGAAGTAGGCGGTAAGCCTGGGCGATCCGG

guest47_0_1_9

Image 01

Genome: AACCGCGTAACAAATGTCCGCGCACTTAGG

guest47_0_1_25

Image 01

Genome: ATATATTGAGGAGGGTGCGGCTAGATTCCT