header

genetic-algorithms.com

 

Inspect guest47_0_1_25

Parents

Mother

Image 01

guest47_0_0_17

Genome: ATATGTTGAGGAGGGTGCCCATAGATTCCT

Father

Image 01

guest47_0_0_9

Genome: GCAGTCAGGCTTTAAGCCTGGGGGATCGGA

guest47_0_1_25

Image 01

  • Creator: guest47
  • Population: 0
  • Generation: 1
  • Total Fitness: 4
  • No. Votes: 1
  • Avg. Fitness 4
  • Created: 05/19/2019
  • Genome: ATATATTGAGGAGGGTGCGGCTAGATTCCT
  • Function:

    logn(numbers("xyx") if numbers('rrr') > numbers('xry') else numbers('xry') if numbers('xry') > numbers('xry') else numbers("xyx") if numbers("xyx") if numbers('rrr') > numbers('xry') else numbers('xry') > numbers('xry') else numbers('xry') if numbers('xry') if numbers("xyx") > numbers('xry') if numbers('xry') > numbers("xyx") else numbers('rrr') else numbers('xry') > numbers('xry') if numbers('rrr') > numbers("xyx") else numbers('xry') else numbers('xry'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest47_0_2_17

Image 01

Genome: AATACCAGATCCCCTCCATCAGATGTGAAGGAA