header

genetic-algorithms.com

 

Inspect guest47_0_0_11

Parents

guest47_0_0_11 has no parents. It was generated at random.

guest47_0_0_11

Image 01

  • Creator: guest47
  • Population: 0
  • Generation: 0
  • Total Fitness: 10
  • No. Votes: 1
  • Avg. Fitness 10
  • Created: 05/19/2019
  • Genome: GGTTTACATCTATTCAGAAGTAAGTCTATT
  • Function:

    max(numbers("xyx") if numbers("xxr") > numbers('ryy') else numbers('xyy'), numbers("xxr")) if numbers("xxr") > numbers("xyx") if numbers('xyy') > numbers('ryy') else numbers("xxr") else minus(max(numbers("xyx") if numbers("xxr") > numbers('xyy') else numbers('ryy'), numbers("xxr")), numbers('ryy') if numbers('xyy') > numbers("xxr") else numbers("xyx")) if numbers('ryy') if numbers("xyx") > numbers("xxr") else numbers('xyy') > minus(max(numbers('xyy') if numbers('ryy') > numbers("xxr") else numbers("xyx"), numbers("xxr")), numbers("xyx") if numbers('ryy') > numbers('xyy') else numbers("xxr")) else max(numbers('xyy') if numbers("xxr") > numbers("xyx") else numbers('ryy'), numbers("xxr"))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest47_0_1_18

Image 01

Genome: GGTTTGCATCTATTCTGCCGTAAGTCTATT

guest47_0_1_22

Image 01

Genome: TGTTCCAATGTGCCCAACAAAAGTAAGTCAGTA

guest47_0_1_20

Image 01

Genome: TTCCGCTTACAGCTCTGCAGAAGTAAGTCTATA

guest47_0_1_1

Image 01

Genome: GGAGTCAGGCTTTAAGCCTGGGGGATCGGA