header

genetic-algorithms.com

 

Inspect guest47_0_1_22

Parents

Mother

Image 01

guest47_0_0_29

Genome: TCCAATGTTCCAAAGGAATCGCGCTGAGTA

Father

Image 01

guest47_0_0_11

Genome: GGTTTACATCTATTCAGAAGTAAGTCTATT

guest47_0_1_22

Image 01

  • Creator: guest47
  • Population: 0
  • Generation: 1
  • Total Fitness: 6
  • No. Votes: 1
  • Avg. Fitness 6
  • Created: 05/19/2019
  • Genome: TGTTCCAATGTGCCCAACAAAAGTAAGTCAGTA
  • Function:

    product(square(numbers("xxx")), numbers("xxx")) if numbers("xxx") if numbers('ryy') > product(square(numbers("xxx")), numbers("xxx")) else square(numbers("xxx")) > noise(numbers("xxx") if square(numbers("xxx")) > numbers('ryy') else product(square(numbers("xxx")), numbers("xxx"))) else square(numbers("xxx")) if product(square(numbers("xxx")), numbers("xxx")) > numbers("xxx") else numbers('ryy') if noise(numbers("xxx") if numbers('ryy') > square(numbers("xxx")) else product(square(numbers("xxx")), numbers("xxx"))) > product(square(numbers("xxx")), numbers("xxx")) else square(numbers("xxx"))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest47_0_2_13

Image 01

Genome: GTTATATTGCCACTCAGGTATGTAGTAACC