header

genetic-algorithms.com

 

Inspect global_global_0_0_186

Parents

global_global_0_0_186 has no parents. It was generated at random.

global_global_0_0_186

Image 01

  • Creator: global
  • Population: 0 (Global)
  • Generation: 0
  • Total Fitness: 25
  • No. Votes: 3
  • Avg. Fitness 8.3
  • Created: 05/19/2019
  • Genome: AGGCTATTGTCGACGGAGGAGTTATAGACT
  • Function:

    tan(max(numbers("xyx") if numbers("xyx") > 100 *(numbers("xyx")) else numbers("per") if numbers("xyx") > numbers("xyx") else 100 *(numbers("xyx")), numbers("xyx") if 100 *(numbers("xyx")) > numbers("per") else numbers("xyx")))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest52_0_1_117

Image 01

Genome: TTAAGGCTATTGTCGACCCGCGAGGAATAGACT

sina12345_0_1_181

Image 01

Genome: TGCAGGCTCTTGTCGACGGAGGAGGCACTGATT

sina12345_0_1_237

Image 01

Genome: AGGCTATTGTCGCCGGAGGAGTTATAGACT

sina12345_0_1_167

Image 01

Genome: TTCCACATAACTTTAGGCGGCGAATTAACA

sina12345_0_1_182

Image 01

Genome: TCGTTACTGGCGACGGAGCACCACAAGCCA