header

genetic-algorithms.com

 

Inspect guest52_global_0_1_117

Parents

Mother

Image 01

global_global_0_0_186

Genome: AGGCTATTGTCGACGGAGGAGTTATAGACT

Father

Image 01

global_global_0_0_7

Genome: CTAGACTGAGTAGGCCGCGAGGACTGAAGT

guest52_global_0_1_117

Image 01

  • Creator: guest52
  • Population: 0 (Global)
  • Generation: 1
  • Total Fitness: 20
  • No. Votes: 2
  • Avg. Fitness 10
  • Created: 05/19/2019
  • Genome: TTAAGGCTATTGTCGACCCGCGAGGAATAGACT
  • Function:

    numbers("xxx") if 10 *(numbers('xry')) > numbers('xry') else numbers("xyx") if tan(max(10 *(numbers('xry')) if numbers('xry') > numbers("xyx") else numbers('xry') if numbers("xxx") > numbers("xyx") else 10 *(numbers('xry')), 10 *(numbers('xry')) if numbers("xxx") > numbers("xyx") else numbers('xry'))) > numbers("xyx") if 10 *(numbers('xry')) > numbers('xry') else numbers("xyx") if numbers("xxx") > 10 *(numbers('xry')) else numbers('xry') else max(numbers('xry') if numbers("xyx") > numbers('xry') if 10 *(numbers('xry')) > numbers("xyx") else numbers("xxx") else 10 *(numbers('xry')), 10 *(numbers('xry')) if numbers("xyx") > numbers("xxx") else numbers('xry'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest94_0_2_141

Image 01

Genome: GGTAGTTCAAGTGTCCGCGTGGGTCCTTCAAAGACT

guest75_0_2_127

Image 01

Genome: AGGCCCGGCACTAAACCTGGCGAGAAATGA

sina12345_0_2_78

Image 01

Genome: CTTACTTGCCCAGTATCGGTCCGCGATTTGTAGACT