header

genetic-algorithms.com

 

Inspect Jade_0_5_6

Parents

Mother

Image 01

Jade_0_4_9

Genome: TGACCGAGGAGCTTTTATAGTGGTGTAGAG

Father

Image 01

Jade_0_4_29

Genome: CTAGTCGATAGGTACAGGTAGCTAATCGTG

Jade_0_5_6

Image 01

  • Creator: Jade
  • Population: 0
  • Generation: 5
  • Total Fitness: 10
  • No. Votes: 1
  • Avg. Fitness 10
  • Created: 12/05/2019
  • Genome: TGACCGAATAGGGACTATAGTAGGGTAGAG
  • Function:

    numbers("per") if numbers('yxr') > numbers("yxx") else numbers('ryy') if divide(noise(tan(numbers("yxx") if numbers('yxr') > numbers('ryy') else numbers("per"))), tan(numbers('yxr') if numbers("yxx") > numbers('ryy') else numbers("per"))) > noise(tan(numbers("per") if numbers('ryy') > numbers('yxr') else numbers("yxx"))) else tan(numbers('yxr') if numbers("per") > numbers("yxx") else numbers('ryy'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

Jade_0_6_25

Image 01

Genome: GCCTGACCGAAGAGAAGCTGTCCCGAGTCTGAG

Jade_0_6_24

Image 01

Genome: TGGCCGCATAGGGACTAAAGTATAGTTCTG

Jade_0_6_19

Image 01

Genome: GCGGGACCGAATAGGGACCGTAGTAGGAAAGAG

Jade_0_6_3

Image 01

Genome: CCTTGACCGAATAGGGACTATAGTAGGGTAGAG