header

genetic-algorithms.com

 

Inspect Jade_0_6_25

Parents

Mother

Image 01

Jade_0_5_6

Genome: TGACCGAATAGGGACTATAGTAGGGTAGAG

Father

Image 01

Jade_0_5_7

Genome: CTGTCAGCGAGGAGCTGTTCCGAGTCTATACAG

Jade_0_6_25

Image 01

  • Creator: Jade
  • Population: 0
  • Generation: 6
  • Total Fitness: 10
  • No. Votes: 1
  • Avg. Fitness 10
  • Created: 12/05/2019
  • Genome: GCCTGACCGAAGAGAAGCTGTCCCGAGTCTGAG
  • Function:

    sin(cos(numbers('ryy'))) if cos(numbers('ryy')) > divide(invert(sin(cos(numbers('ryy')))), sin(cos(numbers('ryy')))) else invert(sin(cos(numbers('ryy')))) if sin(cos(numbers('ryy'))) > invert(sin(cos(numbers('ryy')))) else divide(invert(sin(cos(numbers('ryy')))), sin(cos(numbers('ryy'))))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

Jade_0_7_14

Image 01

Genome: GCCTGACCGAAGAGAAGTTATACCGAGTCTGAG