• Creator: Jade
• Population: 0
• Generation: 10
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 12/06/2019
• Genome: TGCCCTTATACCACCACTAAGGCTATTGAC
• Function:

  10 *(10 *(numbers('xyy'))) if divide(numbers("xyx") if 10 *(numbers('xyy')) > 10 *(10 *(numbers('xyy'))) else numbers('xyy'), 10 *(10 *(numbers('xyy')))) > 10 *(numbers('xyy')) else numbers("xyx") if numbers('xyy') > 10 *(10 *(numbers('xyy'))) else 10 *(numbers('xyy'))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.