• Creator: Jade
• Population: 0
• Generation: 9
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 12/06/2019
• Genome: CTCTACCCTTATACCACTAATGCTTGTATTCAC
• Function:

  min(2 *(numbers("yxx")) if divide(2 *(numbers("yxx")) if 10 *(2 *(numbers("yxx"))) > numbers('xyy') else numbers("yxx"), 10 *(2 *(numbers("yxx")))) > 10 *(2 *(numbers("yxx"))) else 10 *(2 *(numbers("yxx"))) if numbers('xyy') > numbers("yxx") else 2 *(numbers("yxx")), divide(2 *(numbers("yxx")) if 10 *(2 *(numbers("yxx"))) > numbers("yxx") else numbers('xyy'), 10 *(2 *(numbers("yxx")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.