header

genetic-algorithms.com

 

Inspect guest52_global_0_1_121

Parents

Mother

Image 01

global_global_0_0_155

Genome: TAATATTTGATCGCCAACGTTCAATCTGAG

Father

Image 01

global_global_0_0_131

Genome: TAGCAGATACTCCTGACCCGTGTGGCGGCA

guest52_global_0_1_121

Image 01

  • Creator: guest52
  • Population: 0 (Global)
  • Generation: 1
  • Total Fitness: 5
  • No. Votes: 1
  • Avg. Fitness 5
  • Created: 05/19/2019
  • Genome: CTATAATATTTACTCCTGACCTGTGTGTCAGAC
  • Function:

    max(numbers('ryy') if mean(numbers('yyx'), numbers('ryy')) > numbers('yyx') else min(mean(numbers('yyx'), numbers('ryy')), numbers('yyx')) if min(mean(numbers('yyx'), numbers('ryy')), numbers('yyx')) > mean(numbers('yyx'), numbers('ryy')) else mean(numbers('yyx'), numbers('ryy')) if numbers('yyx') if mean(numbers('yyx'), numbers('ryy')) > min(mean(numbers('yyx'), numbers('ryy')), numbers('yyx')) else numbers('ryy') > min(mean(numbers('yyx'), numbers('ryy')), numbers('yyx')) else numbers('yyx'), min(mean(numbers('yyx'), numbers('ryy')), numbers('yyx')) if mean(numbers('yyx'), numbers('ryy')) > numbers('yyx') else numbers('yyx') if numbers('ryy') > mean(numbers('yyx'), numbers('ryy')) else min(mean(numbers('yyx'), numbers('ryy')), numbers('yyx')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

sina12345_0_2_74

Image 01

Genome: AATGGAGTCGGCGAACCCCTGGGTCGGCGAGAA