• Creator: guest52
• Population: 0 (Global)
• Generation: 1
• Total Fitness: 23
• No. Votes: 4
• Avg. Fitness 5.8
• Created: 05/19/2019
• Genome: GAATCAACTATGCCCCGGGTCCGTGCGGTATGG
• Function:

  2 *(sqrt(product(exp(numbers('rep'), numbers('ryy')), numbers('rep')))) if sqrt(product(exp(numbers('rep'), numbers('ryy')), numbers('rep'))) > product(exp(numbers('rep'), numbers('ryy')), numbers('rep')) else exp(numbers('rep'), numbers('ryy')) if product(exp(numbers('rep'), numbers('ryy')), numbers('rep')) > sqrt(product(exp(numbers('rep'), numbers('ryy')), numbers('rep'))) else 2 *(sqrt(product(exp(numbers('rep'), numbers('ryy')), numbers('rep'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.