• Creator: global
• Population: 0 (Global)
• Generation: 0
• Total Fitness: 16
• No. Votes: 3
• Avg. Fitness 5.3
• Created: 05/19/2019
• Genome: TCGACTATGCCCCGGGTCCGTCCGAGCCGG
• Function:

  exp(numbers('rep'), numbers('ryy')) if product(exp(numbers('rep'), numbers('ryy')), numbers('rep')) > sqrt(product(exp(numbers('rep'), numbers('ryy')), numbers('rep'))) else 2 *(sqrt(product(exp(numbers('rep'), numbers('ryy')), numbers('rep'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.