header

genetic-algorithms.com

 

Inspect Jade_0_41_12

Parents

Mother

Image 01

Jade_0_40_27

Genome: CAATCCATAAATCGGGCCTACTTACCAATT

Father

Image 01

Jade_0_40_6

Genome: GTCGAGGTATTATACCAGCGTCGGATGAGAAGC

Jade_0_41_12

Image 01

  • Creator: Jade
  • Population: 0
  • Generation: 41
  • Total Fitness: 10
  • No. Votes: 1
  • Avg. Fitness 10
  • Created: 12/06/2019
  • Genome: CAATCCATACAATACCAGGGTCGGATGATT
  • Function:

    sum(numbers('yxr') if numbers('epe') > numbers('ryy') else numbers("xyx") if logn(sum(numbers("xyx") if numbers('ryy') > numbers('yxr') else numbers('epe'), numbers("xyx"))) > numbers("xyx") else sum(numbers('yxr') if numbers('ryy') > numbers('epe') else numbers("xyx"), numbers("xyx")), logn(sum(numbers('yxr') if numbers("xyx") > numbers('epe') else numbers('ryy'), numbers("xyx"))))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

Jade_0_42_26

Image 01

Genome: CAATCCATACAATACCTCCTTGCATTGATT

Jade_0_42_22

Image 01

Genome: CACTCCAAACAATACCAGCGAACAATGATT

Jade_0_42_19

Image 01

Genome: GTTCAATCCATGAATGATCCTGGTCGGCTGATT

Jade_0_42_2

Image 01

Genome: CCTCAATCCATACAATACCAGGGTCGGATGATT

Jade_0_42_9

Image 01

Genome: GGTATCATACAATACCAGGGAATCCGACTT

Jade_0_42_4

Image 01

Genome: TTCGGACGTCGCTGAGCATAGACGCCATAATAT