header

genetic-algorithms.com

 

Inspect Jade_0_42_2

Parents

Mother

Image 01

Jade_0_41_12

Genome: CAATCCATACAATACCAGGGTCGGATGATT

Father

Image 01

Jade_0_41_19

Genome: CAGGATGTAATATAGCAGTGTCGGATGACAAGC

Jade_0_42_2

Image 01

  • Creator: Jade
  • Population: 0
  • Generation: 42
  • Total Fitness: 10
  • No. Votes: 1
  • Avg. Fitness 10
  • Created: 12/06/2019
  • Genome: CCTCAATCCATACAATACCAGGGTCGGATGATT
  • Function:

    divide(sum(numbers("xyx") if sum(numbers('ryy') if numbers('epe') > numbers("xyx") else numbers('yxr'), numbers("xyx")) > logn(sum(numbers('ryy') if numbers("xyx") > numbers('epe') else numbers('yxr'), numbers("xyx"))) else numbers("xyx") if numbers('yxr') > numbers('ryy') else numbers('epe'), logn(sum(numbers('ryy') if numbers('yxr') > numbers("xyx") else numbers('epe'), numbers("xyx")))), numbers('epe') if numbers('ryy') > numbers('yxr') else numbers("xyx") if sum(numbers('ryy') if numbers("xyx") > numbers('yxr') else numbers('epe'), numbers("xyx")) > logn(sum(numbers('yxr') if numbers("xyx") > numbers('ryy') else numbers('epe'), numbers("xyx"))) else numbers("xyx"))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

Jade_0_43_16

Image 01

Genome: CGTCCTCAATCCGTACGATACCGCCTCCGGATGATT

Jade_0_43_3

Image 01

Genome: TTCTCTCACTACATACAATACTGTCGAACAAGAATT

Jade_0_43_25

Image 01

Genome: GGGCTTATCATACAATACCAGGATCGGCTC

Jade_0_43_21

Image 01

Genome: TGACTTGAGGTATTATAATAGCAGGGTCGGAAA

Jade_0_43_7

Image 01

Genome: ACGTGTATCATACAAGACCATTGAATCCGACTT

Jade_0_43_0

Image 01

Genome: CCCGTACGTATACAATACCAGGGTCGGATGAGC