• Creator: Jade
• Population: 0
• Generation: 42
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 12/06/2019
• Genome: CAAGGACGAACTCGGACGCCTCGGATGACT
• Function:

  sum(2 *(exp(numbers('yxy'), numbers('xyy'))) if exp(numbers('yxy'), numbers('xyy')) > numbers('yxy') else mod(2 *(exp(numbers('yxy'), numbers('xyy'))), exp(numbers('yxy'), numbers('xyy'))), mod(2 *(exp(numbers('yxy'), numbers('xyy'))), exp(numbers('yxy'), numbers('xyy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.