• Creator: Jade
• Population: 0
• Generation: 43
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 12/06/2019
• Genome: AAACAAGGACGCACTCGGACGCCCCTGATGACT
• Function:

  abs(sum(2 *(exp(numbers('yxy'), numbers('yyx'))) if exp(numbers('yxy'), numbers('yyx')) > round(2 *(exp(numbers('yxy'), numbers('yyx'))), exp(numbers('yxy'), numbers('yyx'))) else numbers('yxy'), round(2 *(exp(numbers('yxy'), numbers('yyx'))), exp(numbers('yxy'), numbers('yyx')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.