• Creator: Jade
• Population: 0
• Generation: 44
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 12/06/2019
• Genome: AAACAAGGACGCACTCGGACACTCCTGATGACT
• Function:

  abs(sum(round(2 *(exp(numbers("yyy"), numbers('rep'))), exp(numbers("yyy"), numbers('rep'))) if 2 *(exp(numbers("yyy"), numbers('rep'))) > numbers("yyy") else exp(numbers("yyy"), numbers('rep')), round(2 *(exp(numbers("yyy"), numbers('rep'))), exp(numbers("yyy"), numbers('rep')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.