• Creator: guest1118
• Population: 0 (Global)
• Generation: 4
• Total Fitness: 9
• No. Votes: 1
• Avg. Fitness 9
• Created: 02/03/2020
• Genome: AGAATTCGCACGCCTTATACGGCTTGATCT
• Function:

  sin(gradient[0](round(100 *(divide(numbers("yxx"), numbers('yxy'))), divide(numbers("yxx"), numbers('yxy')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.