• Creator: global
• Population: 0 (Global)
• Generation: 3
• Total Fitness: 10
• No. Votes: 2
• Avg. Fitness 5
• Created: 05/19/2019
• Genome: AGAATTCGCACGCCTTATACGGCTTGAACT
• Function:

  sin(gradient[0](round(100 *(divide(numbers("yxx"), numbers('yxy'))), divide(numbers("yxx"), numbers('yxy')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.