• Creator: guest63
• Population: 0
• Generation: 0
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 05/19/2019
• Genome: CTATAGCGGCGCACATAGGCTGAGGACGGC
• Function:

  max(gradient[2](numbers("xyx")) if exp(round(gradient[2](numbers("xyx")), numbers("xyx")), gradient[2](numbers("xyx"))) > round(gradient[2](numbers("xyx")), numbers("xyx")) else numbers("xyx"), exp(round(gradient[2](numbers("xyx")), numbers("xyx")), gradient[2](numbers("xyx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.